Search Est mb_nossh.01.O8.u

Parameters - *Result* : 1 ESTs
parameter	value
name	mb_nossh.01.O8.u

Est mb_nossh.01.O8.u
Est	Library	acc	length	contig	numseq in contig	length consensus
mb_nossh.01.O8.u	mb_nossh	CK641363	250	mb_nossh.01.O8.u	1	250


>CK641363 mb_nossh.01.O8.u from EST library mb_nossh (Manihot esculenta) - orientation u'
cctgccctttgtttaccttagcgaaaatgacagtcttggctggaaaagaagatggggttg
aaagagaaacagaatgagaaaccttaagaccaaaaaattgagaatgtgatggtttagaca
gaagtgggagatgttgagaagagtaaaattggggagtgggtttctgagcaggaagcagag
aggggagagaataattaggcagagaaatggaagccatttgagagagagttctcaagttgg
aagcttttgg

Factor values for mb_nossh.01.O8.u
Factor	Value
cultivar	MBra685
inoculate	Yes
pathogen	Xanthomonas axonopodis pv. manihotis
strain	CIO-151
time post inoculation	pool (6, 12, 24, 48 and 72 hai and 7dai)
type of library	No subtacted
tissu	Stem
vector	pGMT-easy
reaction to xam	Resistant

Order by	name acc length orientation

Order by

name acc length orientation

start - search by factor, by lib, by est, by contig --- blast